Skip to main content

Advertisement

Table 1 Primer information for 30 microsatellite markers used in this study*

From: Discrimination of the commercial Korean native chicken population using microsatellite markers

Marker Chr. Dye Forward (5′ → 3′) Reverse (5′ → 3′) Allele size (bp)
ADL0268 1 PET CTCCACCCCTCTCAGAACTA CAACTTCCCATCTACCTACT 105-117
MCW0111 1 NED GCTCCATGTGAAGTGGTTTA ATGTCCACTTGTCAATGATG 98-112
MCW0145 1 FAM ACTTTATTCTCCAAATTTGGCT AAACACAATGGCAACGGAAAC 181-211
MCW0063 2 FAM GGCTCCAAAAGCTTGTTCTTAGCT GAAAACCAGTAAAGCTTCTTAC 132-150
MCW0087 2 NED ATTTCTGCAGCCAACTTGGAG CTCAGGCAGTTCTCAAGAACA 267-283
LEI0141 2 FAM CGCATTTGATGCATAACACATG AAGGCAAACTCAGCTGGAACG 220-242
MCW0039 2 VIC CATTGGACTGAGATGTCACTGCAG ACATTTGTCTAATGGTACTGTTAC 127-147
MCW0264 2 FAM CTTACTTTTCACGACAGAAGC AGACTGAGTCACACTCGTAAG 224-240
MCW0288 2 FAM GATCTGCTTCTCTGCCCCATG GGTACTGTCACCAGAATGAGC 108-122
MCW0127 3 VIC GAGTTCAGCAGGAATGGGATG TGCAATAAGAGAAGGTAAGGTC 227-241
MCW0040 3 VIC ACTCAAAAATGTGGTAGAATATAG ACCGAAATTGAGCAGAAGTTA 121-145
ADL0317 4 FAM AGTTGGTTTCAGCCATCCAT CCCAGAGCACACTGTCACTG 178-204
LEI0094 4 FAM GATCTCACCAGTATGAGCTGC TCTCACACTGTAACACAGTGC 254-280
ADL0292 5 FAM CCAAATCAGGCAAAACTTCT AAATGGCCTAAGGATGAGGA 110-138
MCW0029 5 VIC GTGGACACCCATTTGTACCCTATG CATGCAATTCAGGACCGTGCA 139-189
ROS0013 5 NED TGCTGCTCCTGGRAAATTG GAAAAGCCATGGAGGAATCA 220-242
ADL0159 6 VIC GCCATTATTTTTCCCTGTGT CTCCCCAAAGTCATTAGCAG 107-127
ROS0019 7 NED ATGTACAGGTTCCAGTGTCCG CCAGTTCATACAACCTTGAGTTGG 119-143
ADL0259 9 VIC CTCATTGCAGAGGAAGTTCT GTAATGGAGGATGCTCAGGT 107-129
GCT0016 9 NED TCCAAGGTTCTCCAGTTC GGCATAAGGATAGCAACAG 109-125
MCW0228 10 PET GATCTCTGCATTACAAGCATG TTGCTGACCTGCTCATGCAAG 221-239
MCW0104 13 FAM TAGCACAACTCAAGCTGTGAG AGACTTGCACAGCTGTGTACC 189-225
ROS0083 13 VIC CATTACAGCTCAGTGTTGGCA TTGCAAGTGCTCTCCCATC 109-129
MCW0213 13 NED GACAAGTCAACAACTTGCCAG CTGTTCACTTTAAGGACATGG 288-316
MCW0123 14 FAM CCACTAGAAAAGAACATCCTC GGCTGATGTAAGAAGGGATGA 79-89
ADL0293 17 PET GTAATCTAGAAACCCCATCT ACATACCGCAGTCTTTGTTC 105-119
MCW0330 17 VIC TGGACCTCATCAGTCTGACAG AATGTTCTCATAGAGTTCCTGC 254-286
ADL0304 18 FAM GGGGAGGAACTCTGGAAATG CCTCATGCTTCGTGCTTTTT 137-159
LEI0074 26 VIC GACCTGGTCCTGACATGGGTG GTTTGCTGATTAGCCATCGCG 224-240
LEI0135 28 NED CACAATGAAGGATGAATAGTGC AATTCACAGTTACACCTGAGG 131-142
  1. *Bold is selected 12 MS marker combination.