Skip to main content

Advertisement

Table 1 Primer pairs designed for real-time PCR (qPCR)

From: Effect of dietary supplementation with Spirulina on the expressions of AANAT, ADRB3, BTG2 and FASN genes in the subcutaneous adipose and Longissimus dorsi muscle tissues of purebred and crossbred Australian sheep

a Gene symbol qPCR primers b T a Amplicon size (bp)
  Forward Primer Reverse Primer   
AANAT ACTGACCTTCACGGAGATGC TTCACTCATTCTCCCCGTTC 60 211
ADRB3 TCAGTAGGAAGCGGGTCGGG GGCTGGGGAAGGGCAGAGTT 60 291
BTG2 CTGGAGGAGAACTGGCTGTC AAAACAATGCCCAAGGTCTG 60 194
FASN GTGTGGTACAGCCCCTCAAG ACGCACCTGAATGACCACTT 60 110
Reference genes     
UBC CGTCTTAGGGGTGGCTGTTA AAATTGGGGTAAATGGCTAGA 60 90
PPIA TCATTTGCACTGCCAAGACTG TCATGCCCTCTTTCACTTTGC 60 72
  1. aAralkylamine N-acetyltransferase = AANAT, β3-adrenergic receptor = ADRB3, B-cell translocation gene 2 = BTG2, Fatty acid synthase = FASN, Ubiquitin C = UBC, Peptidyl-prolyl cis-trans isomeraseA = PPIA, bTa = Empirical annealing Temperature.