Skip to main content

Advertisement

Table 1 Primer sequences for characterization of bovine IZUMO1

From: Molecular cloning and characterization of Izumo1 gene from bovine testis

  Sense primer (5′ to 3′) Anti sense primer (5′ to 3′)
RT-PCR GAGCGCGAAGTCAAGGTCCATC GCCGTCTCATCCTGAGTTTCGGTGT
Anti-body CTCGAGGTTGTCGATGAGGCCACACTG TCTAGAGTCCAGGATCATGTCTTCCAT