Skip to main content

Advertisement

Table 1 Information of evaluated internal control genes and their primer sequences

From: GAPDH, β-actin and β2-microglobulin, as three common reference genes, are not reliable for gene expression studies in equine adipose- and marrow-derived mesenchymal stem cells

Reference gene Accession number function Forward primer Reverse primer Amplicon size (bp)
Glyceraldehyde-3- phosphate dehydrogenase (GAPDH) NM_001163856 Oxidoreductase in glycolysis and gluconeogenesis TGTCATCAACGGAAAGGC GCATCAGCAGAAGGAGCA 183
β-actin NM_001081838 Cytoskeletal structural protein GGGCATCCTGACCCTCAAG TCCATGTCGTCCCAGTTGGT 63
Β2-microglobulin (B2M) NM_001082502 A component of MHC class I molecule CGAAGGTTCAGGTTTACTCACG ATTTCAATCTCAGGCGGA 97