Skip to main content

Advertisement

Table 2 Real-time PCR primer sequences

From: A comparison of supplemental calcium soap of palm fatty acids versus tallow in a corn-based finishing diet for feedlot steers

Target gene Primer sequence Accession #
GAPDH F: GATTGTCAGCAATGCCTCCT NM_001034034.2
R: GGTCATAAGTCCCTCCACGA
Leptin F: TGTGGCTTTGGCCCTATCTG NM_173928.2
R: CGGACTGCGTGTGTGAGATG
Lipoprotein lipase F: ATACACCAACCAGGCCTTCG NM_001075120.1
R: GCTTTGCCAAGTTTCAGCCA
Fatty acid synthase F: CTGCCGAAGACAGGGATTGT NM_001012669.1
R: TGTACAGCTTCTGCTGGTGG
Stearoyl-CoA desaturase F: CCTGTGGAGTCACCGAACC NM_173959.4
R: CAAAAACGTCATTCTGGAACGC