Skip to main content

Advertisement

Table 1 The RT-PCR and qRT-PCR primers used in this study

From: Expression patterns of TRα and CRABPII genes in Chinese cashmere goat skin during prenatal development

Primer Name Sequence (5’-3’) Fragment size (bp) T.M. (°C)
Cloning primers
TRα-1 F CCTGGATGGAATTGAAGTGA 799 62.0
TRα-1R GACATGATCTCCATGCAGC   
TRα-2 F AGGCCTTCAGCGAGTTTAC 652 59.0
TRα-2R CCTTCTCTCCAGGCTCCTC   
CRABPII-1 F CAGTGCTCCAGTGGAAAGA 563 56.5
CRABPII-1R CCAGAAGTGATTGGGTGAG   
Real-time PCR primers
TRα-3 F TTACCTGGACAAAGACGAGC 113 57.4
TRα-3R TCTGGATTGTGCGGCGAAAG   
CRABPII-2 F ACATCAAAACCTCCACCACC 111 56.5
CRABPII-2R CCCATTTCACCAGGCTCTTA   
ACTB-F CCTGCGGCATTCACGAAACTAC 87 58.5
ACTB-R ACAGCACCGTGTTGGCGTAGAG   
GAPDH-F GCA AGTTCCACGGCACAG 249 59.0
GAPDH-R GGT TCACGCCCATCACAA   
TOP2B-F GTGTGGAGCCTGAGTGGTATA 137 59.0
TOP2B-R AAGCATTCGCCTGACATTGTT