Skip to main content

Table 1 The information of primers for PCR and MassArray

From: A synonymous mutation of uncoupling protein 2 (UCP2) gene is associated with growth performance, carcass characteristics and meat quality in rabbits

Primer Purpose Primer sequence (5′ → 3′) Amplicon size (bp) Tm (°C)
P1 Amplify exon 1 F: CTGCTTAGGGACTTGGTGCTGT 690 58.0
P2 c.72G>A genotyping 1st: ACGTTGGATGTCCTTCCTCCTGCAGGCAC 102 49.8