Skip to main content

Table 1 Forward and Reverse Primers used for real time PCR

From: Effects of liposomal-curcumin on five opportunistic bacterial strains found in the equine hindgut - preliminary study

Strains Forward Primers (5′ – 3′) Reverse Primers (5′ – 3′)
SBEC GCCTACATGAAGTCGGAATCG TACAAGGCCCGGGAACGTA
C. difficile CAAGTTGAGCGATTTACTTCGGTAA CTAATCAGACGCGGGTCCAT
C. perfringens AAATGTAACAGCAGGGGCA TGAAATTGCAGCAACTCTAGC
E. coli, general GTTAATACCTTTGCTCATTGA ACCAGGGTATCTAATCCTGTT
E. coli K12 GCTACAATGGCGCATACAAA TTCATGGAGTCGAGTTGCAG