Skip to main content

Table 2 Nucleotide changes in the sequence of the oligonucleotides used as primers for PCR and sequencing compared to the sequences in several species of Cetartiodactyla analyzed in this study

From: Sequence variation of necdin gene in Bovidae

Gene NDN-FCd NDN-FUp NDN-RCd
Cattle GGAAAGCAGACTCGAAGAGC GAGTTTTCGCTGGTCAAAGC GCTTTCGCTTTTGTGCTACC
Yak GGAAAGCAGACTCGAAGAGC GAGTTTTCGCTGGTCAAAGC GCTTTCGCTTTTGTGCTACC
Bison GGAAAGCAGACTCGAAGAGC GAGTTTTCGCTGGTCAAAGC GCTTTCGCTTTTGTGCTACC
Buffalo GGAAAGCAGACTCGAAGAGC GAGTTTTCGCTGGTCAAAGC GCTTTCGCTTTTGTGCTACC
Goat GGAAAGCAGACTCGAAGAGC GAGTTTTCGCTGGTCAAAGC GCTTTCGCTTTTGTGCTACC
Sheep GGAAAGCAGACTCGAAGAGC GAGTTTTCGCTGGTCAAAGC GCTTTCGCTTTTGTGCTACC
Oryx GGAAAGCAGACTCGAAGAGC GAGTTTTCGCTGGTCAAAGC GCTTTCGCTTTTGTGCTATC
Giraffe GGAAAGCAGACTCGAAGAGC GAGTTTTCGCTGGTCAAAGC GCTTTCGCTTTTGTGCTACC
Deer GGAAAGCAGACTCGAAGAGC GAGTTTTCGCTGGTCAAAGC GCTTTCGCGTTTGTGCTACC
Pig GGAGCGCAGAGTCGAAGAGC GAGTTCTCGCTGGTCAAAGC GCTTTCGCTTTTGTGCTACC
Camel GGAGCGCACCCTCGAAGAGC GAGTTCTCGCTGGTCAAGGC GCTTTCGCTTTTGTGCTACC